Endpoints

Initiate Screen (Inline)

Initiate a pathogen screen.

Sequences must each be at least 30 base pairs in length. Total base pair count, across all sequences, cannot exceed 1,000,000,000.

Input is a JSON request (Content-Type: application/json) that has the following body format:

{
  "name": "Screen for order #123456",
  "sequences": [
    {
      "name": "cholera toxin A2 [Vibrio cholerae]",
      "sequence": "ATGAGCAACACCTGCGACGAGAAGACCCAGAGCCTGGGCGTGAAGTTCCTGGACGAGTACCAGAGCAAGGTGAAGCGGCAGTACTTCAG"
    }
  ]
}

(This example shows only one sequence, but you may pass in more than one.)

post/v2/screen_inline

Request

  • Base URL: https://api.aclid.bio (the document declares no server; this is the origin it was published from)
  • URL: https://api.aclid.bio/v2/screen_inline
  • Auth: none declared. Required headers: content-type

Headers

content-typestring required

Request body

namestring nullable

A display label that's useful for you to identify this screen. Unused by Aclid.

idempotence_keystring nullable

Optional. Within any 24-hour window, the first screen request with a given idempotence key will be processed normally. However, subsequent screen requests (within 24 hours) with the same idempotence key will not be re-assessed. Instead, those subsequent requests will be redirected (HTTP 303) to the original screen's summary.

asynchronousboolean

Set asynchronous to false for real-time screening results

verification_success_urlstring nullable

URL to redirect to after verification is completed

frameworksstring[] nullable

Default: ['us_ccl_export_control', 'eu_dual_use_export_control', 'us_select_agent', 'us_screening_framework'].

List of frameworks to screen sequences against.

Please refer to this list of available frameworks. Reach out to us if you'd like to add a framework not currently available in the list above or if you'd like to use custom criteria exclusive to your account.

requester_idstring nullable
sequence_type'nucleotide' | 'amino_acid'

Example request

{
  "name": "Order #123456",
  "sequences": [
    {
      "name": "cholera toxin A2 [Vibrio cholerae]",
      "sequence": "ATGAGCAACACCTGCGACGAGAAGACCCAGAGCCTGGGCGTGAAGTTCCTGGACGAGTACCAGAGCAAGGTGAAGCGGCAGTACTTCAG"
    }
  ],
  "idempotence_key": "4202ba63-5122-4904-b2d8-a3cbf81692de"
}

Response

Successful Response

next_cursorstring nullable

Example response

{
  "items": [
    {
      "id": "230408145715_yPSG4Ery",
      "user": "ash.braxton@reallygreatlab.com"
    }
  ]
}

Changes

No recorded changes to this operation across all 1 revision of this API.