Tasks

Find genes and their exon/intron/CDS structure

Structure-aware gene finding: genes with transcript type and exon/intron/CDS structure, each with its own strand, renderable as GFF3 or BED.

Minimum input is 1000 bp — the gene finder needs that much context to be meaningful. This is the bound the document used to advertise as 1 bp.

Detection is strand-insensitive: the same genes are found whether the plus strand or its reverse complement is submitted, and the reported strand is relative to the input. options.reverse_complement (default true) averages each locus with its reverse complement, which improves minus-strand recall at roughly double the cost.

Above 200,000 bp this endpoint requires Prefer: respond-async. A synchronous JSON request over that size is rejected with 413 sync_too_large (error.details carries {sequence_length, threshold}) because sync delivery would outlast the proxy timeout: a 500,000 bp annotation takes about 250 s against a 300 s idle timeout. The threshold is published as a number in x-sync-limit-bp on this operation — read it from there; this sentence is prose and a client cannot pin it.

The cap governs JSON delivery. Async is JSON-only, so a BED or GFF3 request (?format= or Accept: text/x-bed / text/x-gff3) is not refused above the threshold: it is served synchronously at any admitted length. Near the 500,000 bp ceiling that is roughly 250 s of work and can exceed a gateway's 300 s idle timeout, so for long sequence prefer JSON with Prefer: respond-async and render the completed job yourself.

post/v1/tasks/annotation/predict

Request

Base URL: https://api.genomicintelligence.ai
URL: https://api.genomicintelligence.ai/v1/tasks/annotation/predict
Auth: HTTP bearer

Query parameters

formatstring nullable

Output format: json (default) or one of bed, gff3. Text formats are synchronous-only — combining one with Prefer: respond-async is a 400. An unsupported value is a 415 unsupported_format, never a silent fallback to JSON.

Headers

acceptstring nullable

Preferstring nullable

Set to respond-async to dispatch asynchronously: the server returns 202 with {data: {job_id, status, links}, meta} immediately and the result is polled from GET /v1/tasks/jobs/{job_id}. Anything else (or omitting the header) delivers the result synchronously with 200. Async is JSON-only — combining it with a text format is a 400. Some endpoints require it above a size threshold and reject sync delivery with 413 sync_too_large.

Request body

sequencestring required

DNA sequence (A/C/G/T/N, case-insensitive). Whitespace (newlines, spaces, tabs) is stripped first, so a line-wrapped FASTA sequence body may be pasted verbatim; length is measured against the whitespace-stripped string, not the raw character count — so a line-wrapped body can satisfy the published minLength as a raw string and still be rejected once stripped. Count bases, not characters. 1,000–500,000 bp. The 1,000 bp floor applies to every annotation model — the gene finder needs that much context to be meaningful. This is the bound the document previously advertised as 1 bp. Requests outside the range are rejected with 422 validation_failed before any model is loaded.

sequence_namestring nullable

Display name for the sequence (e.g., 'chr1:1000-5000').

modelstring nullable

Model ID. If omitted, the task's default model is used. The valid ids and the default for this operation are published structurally as x-models on the operation itself — deliberately not as an enum here, so that adding a model cannot make a previously-generated client reject a valid id. GET /v1/tasks/{task}/models carries the same roster with full per-model specs.

Example request

{
  "options": {
    "threshold": 0.5
  },
  "sequence": "ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT",
  "sequence_name": "chr1:1000-3000"
}

Response

Successful inference. data is a discriminated union keyed on task — narrow on data.task (or meta.task) to reach task-specific fields; here it is always "annotation". meta.task_specific_counts is the matching counts variant.

Changes

No recorded changes to this operation across all 1 revision of this API.